Review



cell lines miapaca 2 atcc cat  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    ATCC cell lines miapaca 2 atcc cat
    Cell Lines Miapaca 2 Atcc Cat, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 8059 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+lines+miapaca+2+atcc+cat/PANC-1/pm37554459-177-2-5
    Average 99 stars, based on 8059 article reviews
    cell lines miapaca 2 atcc cat - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    Luciferase:

    Article Title: Tomatidine targets ATF4-dependent signaling and induces ferroptosis to limit pancreatic cancer progression.
    Article Snippet: .. Experimental models: Cell lines MiaPaca-2 ATCC Cat#CRL1420; RRID: CVCL_0428 Panc1 ATCC Cat#CRL1469; RRID: CVCL_0480 MT5 Mace et al.,63 KrasLSL G12D, Trp53LSL R270H, and Pdx1-cre mice luciferase-tagged mouse KPC-luc cells Gomez-Chou et al.,64 LSL-KrasG12D/+; TP53loxP/loxP; Pdx1-Cre mice .. ChIP qPCR primer for heIF4EBP1 Integrated DNA Technologies (IDT) (Seq1 CTCCTCCCCTCTCATTGT Seq2 CAGGATCTGTCGCGTTTTCT) ChIP qPCR primer for CHOP (B site) Integrated DNA Technologies (IDT) (Seq1 GTGAGGGCTCTG GGAGGTGCT Seq2 AGGGGGATGTTACCTTTCCCTTCTC) ChIP qPCR primer for ASNS Integrated DNA Technologies (IDT) (Seq1 CCTGTGCGCGCTGGTTGGTCCT Seq2 CGCTTATACCGACCTGGCTCCT) Taqman Gene expression assay primers for ATF4 ThermoFisher Scientific (Hs00909569_g1) Taqman Gene expression assay primers for eIF4EBP1 ThermoFisher Scientific (Hs00607050_m1) Software and algorithms HISAT2 v2.1.0 (RRID:SCR_015530) Kim et al.,65 http://ccb.jhu.edu/software/hisat2/index. shtml FastQC (RRID:SCR_014583) Andrews.



    Similar Products

    cell lines miapaca 2 atcc cat  (ATCC)
    99
    ATCC cell lines miapaca 2 atcc cat
    Cell Lines Miapaca 2 Atcc Cat, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+lines+miapaca+2+atcc+cat/PANC-1/pm37554459-177-2-5
    Average 99 stars, based on 1 article reviews
    cell lines miapaca 2 atcc cat - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    cell line resourse cat no 3111c0001ccc000010 miapaca 2 atcc  (ATCC)
    97
    ATCC cell line resourse cat no 3111c0001ccc000010 miapaca 2 atcc
    Cell Line Resourse Cat No 3111c0001ccc000010 Miapaca 2 Atcc, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+lines+miapaca+2+atcc+cat/MIA+PaCa-2/pm31352078-508-142-149
    Average 97 stars, based on 1 article reviews
    cell line resourse cat no 3111c0001ccc000010 miapaca 2 atcc - by Bioz Stars, 2026-09
    97/100 stars
    		  Buy from Supplier

    Image Search Results